SubtiBank SubtiBank
phrH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

phrH

secreted regulator of the activity of phosphatase [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]
locus
BSU_06839
pI
9.52
mw
6.30 kDa
protein length
gene length
174 bp Sequence Blast
function
control of [SW|sporulation] initiation
product
secreted regulator of the activity of phosphatase [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    752,079 752,252

    The protein

    Protein family

  • [SW|phr family] (according to UniProt)
  • [SW|Localization]

  • secreted as hexapeptide TDRNTT [Pubmed|21908671], uptake by the ([protein|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|OppD]-[protein|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|OppF])-([protein|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|OppB]-[protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|OppC])-[protein|302DFA46D73E18C4663468ED6033C55056744475|OppA] [SW|ABC transporter] [Pubmed|21908671]
  • Expression and Regulation

    Operons

    genes
    [gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]
    description
    [Pubmed|21908671]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21908671], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • regulation

  • ''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab

    genes
    [gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]-[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]
    description
    [Pubmed|21908671]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21908671], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab

    Biological materials

    Mutant

  • BKE06839 ([gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06839 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCCAGACACATCATCACTT, downstream forward: _UP4_TAGGGCTTTTTCTTGCTTTA
  • BKK06839 ([gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06839 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCCAGACACATCATCACTT, downstream forward: _UP4_TAGGGCTTTTTCTTGCTTTA
  • References

  • 16553878