SubtiBank SubtiBank
ytrE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytrE

[SW|ABC transporter] (ATP-binding protein)
locus
BSU_30420
pI
5.98
mw
25.31 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,115,279 3,115,974

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-231) (according to UniProt)
  • Structure

  • [PDB|1L2T] (from Methanocaldococcus jannaschii, 44% identity) [pubmed|12150914]
  • [SW|Localization]

  • cell membrane (via [protein|31977FDC549E45911C333623DCA3D8941A93D8FF|YtrC]-[protein|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|YtrD]) [Pubmed|10986249]
  • Expression and Regulation

    Operons

    genes
    [gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]
    description
    [Pubmed|10986249,21856850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|10986249,21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • expressed early in the stationary phase [Pubmed|10986249]
  • view in new tab

    Biological materials

    Mutant

  • GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [SW|Jörg Stülke]'s lab
  • MGNA-B537 (ytrE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1536 NBRP B. subtilis, Japan]
  • BKE30420 ([gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30420 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_ATCAATCATATGTTCTCTCT, downstream forward: _UP4_GGTGTGCTAAAAGGAGGAAT
  • BKK30420 ([gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAATCATATGTTCTCTCT, downstream forward: _UP4_GGTGTGCTAAAAGGAGGAAT
  • References

  • 10986249,10092453,12399512,22926563,12150914