SubtiBank SubtiBank
fruK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fruK

fructose-1-phosphate kinase
locus
BSU_14390
pI
4.89
mw
32.64 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
fructose utilization
product
fructose-1-phosphate kinase
essential
no
ec
2.7.1.56
synonyms
fruB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.7|Utilization of fructose]
  • Gene

    Coordinates
    1,508,330 1,509,241

    The protein

    Catalyzed reaction/ biological activity

  • ATP + β-D-fructose 1-phosphate --> ADP + β-D-fructose 1,6-bisphosphate + H+ (according to UniProt)
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|3OHR]
  • Expression and Regulation

    Operons

    genes
    [gene|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|fruR]-[gene|502AA809C8C95F8886DD91FBB7DDBECC63342327|fruK]-[gene|973C3D3FBFDCA095A760C5F49A96D8BE48771014|fruA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]: repression, (according to [http://dbtbs.hgc.jp/COG/prom/fruRKA.html DBTBS]), in [regulon|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR regulon]
  • regulation

  • induced in the presence of fructose ([protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]) (according to [http://dbtbs.hgc.jp/COG/prom/fruRKA.html DBTBS])
  • view in new tab

    Biological materials

    Mutant

  • BKE14390 ([gene|502AA809C8C95F8886DD91FBB7DDBECC63342327|fruK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGATTAAGTGTTACAGTGT, downstream forward: _UP4_CGTCTATAGAGGAGGAAACA
  • BKK14390 ([gene|502AA809C8C95F8886DD91FBB7DDBECC63342327|fruK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGATTAAGTGTTACAGTGT, downstream forward: _UP4_CGTCTATAGAGGAGGAAACA
  • References

  • 10627040,23033921