SubtiBank SubtiBank
yutJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yutJ

putative NADH dehydrogenase
locus
BSU_32200
pI
5.82
mw
36.75 kDa
protein length
355 aa Sequence Blast
gene length
1068 bp Sequence Blast
function
unknown
product
putative NADH dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    3,308,867 3,309,934

    The protein

    Protein family

  • NADH dehydrogenase family (with [protein|56F407D408272F3674612C9CDFE4A922680EC694|Ndh] and [protein|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|YumB], according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt) [Pubmed|21635694]
  • Structure

  • [PDB|4XDB] (Ndh from ''S. aureus'', 24% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B575 (yutJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1574 NBRP B. subtilis, Japan]
  • BKE32200 ([gene|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATTCCCCTTTAAT, downstream forward: _UP4_TAATGATAGAGAAGAACCGC
  • BKK32200 ([gene|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATTCCCCTTTAAT, downstream forward: _UP4_TAATGATAGAGAAGAACCGC
  • References

  • 17015645,26883633