SubtiBank SubtiBank
yutJ

yutJ

putative NADH dehydrogenase
locus
BSU_32200
pI
5.82
mw
36.75 kDa
protein length
355 aa Sequence Blast
gene length
1068 bp Sequence Blast
function
unknown
product
putative NADH dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    3,308,867 3,309,934

    The protein

    Protein family

  • NADH dehydrogenase family (with [protein|56F407D408272F3674612C9CDFE4A922680EC694|Ndh] and [protein|9B3E9074975758BCB3D06820E4A35F8C2B78DCEB|YumB], according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt) [Pubmed|21635694]
  • Structure

  • [PDB|4XDB] (Ndh from ''S. aureus'', 24% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B575 (yutJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1574 NBRP B. subtilis, Japan]
  • BKE32200 ([gene|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATTCCCCTTTAAT, downstream forward: _UP4_TAATGATAGAGAAGAACCGC
  • BKK32200 ([gene|5044FDBEC8D81D1978DB431F9222902FCD80DD2D|yutJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATTCCCCTTTAAT, downstream forward: _UP4_TAATGATAGAGAAGAACCGC
  • References

  • 17015645,26883633