SubtiBank SubtiBank
rppH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rppH

decapping of NAD-capped RNAs, error prevention oxidized guanine system, confers protection against oxidative stress to vegetative cells, moreover the protein has RNA pyrophosphohydrolase activity
locus
BSU30630
pI
5.95
mw
18.37 kDa
protein length
158 aa Sequence Blast
gene length
474 bp Sequence Blast
function
DNA repair, RNA degradation
product
8-oxo-dGTPase (antimutator), RNA pyrophosphohydrolase
essential
no
synonyms
mutTA,ytkD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.5|Oxidized guanine (GO) DNA repair system]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.3|RNA pyrophosphohydrolase]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,134,983 → 3,135,459

    The protein

    Catalyzed reaction/ biological activity

  • removal of pyrophosphate from the 5' end of mRNAs to make RNA accessible for degradation by [SW|RNases] [Pubmed|21925382]
  • RppH requires at least two unpaired nucleotides at the 5' end of its RNA substrates and prefers three or more. The second of these 5'-terminal nucleotides must be G, whereas a less strict preference for a purine is evident at the third position, and A is slightly favored over G at the first position [Pubmed|23610425,23610407]
  • decapping of NAD-capped RNAs [pubmed|30110644]
  • Protein family

  • [SW|Nudix hydrolase] family (according to Swiss-Prot)
  • Structure

  • [PDB|4JZV] [Pubmed|23610407]
  • Expression and Regulation

    Operons

    genes
    [gene|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14761999], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|14761999], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during logarithmic growth ([protein|search|SigA]) and early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A297 (ytkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/297 NBRP B. subtilis, Japan]
  • BKE30630 (Δ[gene|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCAAATCC, downstream forward: _UP4_TAAAAAACCCGGCACATGTG
  • BKK30630 (Δ[gene|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCAAATCC, downstream forward: _UP4_TAAAAAACCCGGCACATGTG
  • References

    Reviews

  • 22568516
  • Original publications

  • 16513759,16497325,14761999,19011023,9387221,15576788,21925382,23610425,23610407,30110644