SubtiBank SubtiBank
rppH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rppH

decapping of NAD-capped RNAs, error prevention oxidized guanine system, confers protection against oxidative stress to vegetative cells, moreover the protein has RNA pyrophosphohydrolase activity
locus
BSU_30630
pI
5.95
mw
18.37 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
DNA repair, RNA degradation
product
8-oxo-dGTPase (antimutator), RNA pyrophosphohydrolase
essential
no
synonyms
mutTA,ytkD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.5|Oxidized guanine (GO) DNA repair system]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.3|RNA pyrophosphohydrolase]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,134,983 3,135,459

    The protein

    Catalyzed reaction/ biological activity

  • removal of pyrophosphate from the 5' end of mRNAs to make RNA accessible for degradation by [SW|RNases] [Pubmed|21925382]
  • RppH requires at least two unpaired nucleotides at the 5' end of its RNA substrates and prefers three or more. The second of these 5'-terminal nucleotides must be G, whereas a less strict preference for a purine is evident at the third position, and A is slightly favored over G at the first position [Pubmed|23610425,23610407]
  • decapping of NAD-capped RNAs [pubmed|30110644]
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • Structure

  • [PDB|4JZV] [Pubmed|23610407]
  • Expression and Regulation

    Operons

    genes
    [gene|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14761999], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|14761999], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during logarithmic growth ([protein|search|SigA]) and early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A297 (ytkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/297 NBRP B. subtilis, Japan]
  • BKE30630 ([gene|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCAAATCC, downstream forward: _UP4_TAAAAAACCCGGCACATGTG
  • BKK30630 ([gene|50A50E33796EEF8046142EE928753C355EF42A1A|rppH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCAAATCC, downstream forward: _UP4_TAAAAAACCCGGCACATGTG
  • References

    Reviews

  • 22568516
  • Original publications

  • 16513759,16497325,14761999,19011023,9387221,15576788,21925382,23610425,23610407,30110644