SubtiBank SubtiBank
yneN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yneN

similar to thiol:disulfide oxidoreductase
locus
BSU_18010
pI
7.86
mw
19.23 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,929,481 1,929,993

    The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F7D869F77E2275110737EF658C58FA1BF742D73F|ResA], [protein|0B299F9459023306FA91298A6162A09E4A87C3B2|StoA]
  • Structure

  • [PDB|3ERW] ([protein|0B299F9459023306FA91298A6162A09E4A87C3B2|StoA], 34% identity, aa 42-165) [pubmed|19144642]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1310745], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12591885], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]
  • Biological materials

    Mutant

  • MGNA-B392 (yneN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1391 NBRP B. subtilis, Japan]
  • 1A921 ( ''yneN''::''erm''), [Pubmed|15342593], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A921&Search=1A921 BGSC]
  • BKE18010 ([gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCCACCTCCGCAGCA, downstream forward: _UP4_TAGATTCAGTTTTTTTTATA
  • BKK18010 ([gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCCACCTCCGCAGCA, downstream forward: _UP4_TAGATTCAGTTTTTTTTATA
  • References

  • 22383849,15342593,19144642