SubtiBank SubtiBank
yhdY
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdY

mechanosensitive channel, similar to MscS
locus
BSU_09640
pI
5.76
mw
42.38 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast
function
resistance to osmotic downshock
product
mechanosensitive channel, similar to MscS
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,038,909 1,040,024

    The protein

    Protein family

  • [SW|MscS (TC 1.A.23) family] (according to UniProt)
  • Structure

  • [PDB|4AGE] (MscS from E. coli, corresponds to aa 129 ... 358 of YhdY, 27% identity) [pubmed|23012406]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]
    description
    [Pubmed|21815947]
    view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-A701 (yhdY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/701 NBRP B. subtilis, Japan]
  • 1A958 ( ''yhdY''::''erm''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A958&Search=1A958 BGSC]
  • 1A958 ( ''yhdY''::''erm''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A958&Search=1A958 BGSC]
  • BKE09640 ([gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTGTCTCCCCTCTAT, downstream forward: _UP4_TAAAAGAGAGACTTCGTCTG
  • BKK09640 ([gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTGTCTCCCCTCTAT, downstream forward: _UP4_TAAAAGAGAGACTTCGTCTG
  • References

    Reviews

  • 12626684,22685280,22404681,24607989,17505523
  • Original Publications

  • 17665170,18310427,19252899,21815947,26883633,23012406
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]