SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of genes involved in NAD biosynthesis
19.58 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
regulation of NAD biosynthesis
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,850,716 2,851,258

    The protein


  • [PDB|1J5Y] (from Thermotoga maritima, 38% identity) [pubmed|17256761]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|8444804,16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|8444804,16199587]
  • view in new tab

    Biological materials


  • MGNA-A824 (yrxA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27890 ([gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • BKK27890 ([gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [ homepage]
  • References

  • 18276644,8444804,16199587,17256761