SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor of genes involved in NAD biosynthesis
19.58 kDa
protein length
178 aa Sequence Blast
gene length
534 bp Sequence Blast
regulation of NAD biosynthesis
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,850,716 → 2,851,258

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|8444804,16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|8444804,16199587]
  • view in new tab

    Biological materials


  • MGNA-A824 (yrxA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27890 (Δ[gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • BKK27890 (Δ[gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • Labs working on this gene/protein

  • [SW|Alessandra Albertini], University of Pavia, Italy [ homepage]
  • References

  • 18276644,8444804,16199587