SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor of genes involved in NAD biosynthesis
19.58 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
regulation of NAD biosynthesis
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,850,716 2,851,258

    The protein


  • [PDB|1J5Y] (from Thermotoga maritima, 38% identity) [pubmed|17256761]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|8444804,16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|8444804,16199587]
  • view in new tab

    Biological materials


  • MGNA-A824 (yrxA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27890 ([gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • BKK27890 ([gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCAGCCACAGAAGAA, downstream forward: _UP4_TAAAAAAAGCCCTCTAGTGG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [ homepage]
  • References

  • 18276644,8444804,16199587,17256761