SubtiBank SubtiBank
paiB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

paiB

transcriptional repressor of sporulation and degradative enzyme genes
locus
BSU_32140
pI
5.03
mw
23.96 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
regulation of sporulation, degradative enzyme and motility genes
product
transcriptional repressor
essential
no
synonyms
yumE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,304,096 3,304,719

    The protein

    Protein family

  • paiB family (single member, according to UniProt)
  • Structure

  • [PDB|2OL5] (from Geobacillus stearothermophilus, 39% identity) [pubmed|21633969]
  • Expression and Regulation

    Operons

    genes
    [gene|430E15D61FCCA20FAC2BCCF504A12070794372FD|paiA]-[gene|511CFC625D79AAA8B78809651684E4E409337AFA|paiB]
    description
    [Pubmed|27965289]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A088 (paiB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/88 NBRP B. subtilis, Japan]
  • BKE32140 ([gene|511CFC625D79AAA8B78809651684E4E409337AFA|paiB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCCACCCTTCGA, downstream forward: _UP4_TAAGCTTACTTTGCTGAAGA
  • BKK32140 ([gene|511CFC625D79AAA8B78809651684E4E409337AFA|paiB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCCACCCTTCGA, downstream forward: _UP4_TAAGCTTACTTTGCTGAAGA
  • References

  • 2108124,27965289,21633969