SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


osmo-sensing two-component sensor kinase, phosphorylates Spo0F, part of the phosphorelay, checkpoint protein that links sporulation initiation to biofilm formation
56.54 kDa
protein length
506 aa Sequence Blast
gene length
1518 bp Sequence Blast
initiation of sporulation
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,431,486 → 1,433,006

    Phenotypes of a mutant

  • deletion of ''kinD'' suppresses the [SW|sporulation] defect of matrix mutants, while its overproduction delays [SW|sporulation] [Pubmed|20689749]
  • inactivation of ''[gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], regulates the onset of sporulation by inhibiting the activity of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] until matrix, or a component therein, is sensed [ PubMed]
  • dual role as a [SW|phosphatase] or a [SW|kinase], activity is linked to the presence of extracellular matrix in the biofilms [Pubmed|20689749]
  • mainly active in the younger, outer regions of a colony (with [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]) [Pubmed|21097618]
  • [SW|Domains]

  • two transmembrane segments, between them the extracellular pyruvate-binding sensing domain that consists of tandem PAS-like domains [Pubmed|23436677,22716461]
  • C-terminal histidine phosphotransferase domain
  • see [Pubmed|22716461] for a scheme of the domain organization
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • activity is stimulated by direct or indirect interaction with [protein|4DAB7847EA3848A34432C80124464543FA3DCA0F|Med] [Pubmed|21622736]
  • L-malate seems to trigger KinD activity [Pubmed|22716461], but this effect may be indirect due to the excretion of pyruvate that directly binds the extracytoplasmic sensing domain of KinD [Pubmed|23436677]
  • kinase activity is triggered and phosphatase activity is decreased by increased osmotic pressure [Pubmed|22882172]
  • activity is triggered in the presence of glycerol + manganese [Pubmed|23564171]
  • Structure

  • [PDB|4DBJ] (extracytoplasmic sensing domain) [Pubmed|23436677]
  • [SW|Localization]

  • membrane
  • Biological materials


  • MGNA-B323 (ykvD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13660 (Δ[gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACCTGATTAGAGGTA, downstream forward: _UP4_TAGCCCCCCTGACCATGTCA
  • BKK13660 (Δ[gene|511E71BB1981758857854C8E9BF657287CE60C11|kinD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACCTGATTAGAGGTA, downstream forward: _UP4_TAGCCCCCCTGACCATGTCA
  • References

  • 10094672,11069677,20689749,26297017,21097618,22074846,22716461,22882172,23436677,23564171,21622736,22211522