SubtiBank SubtiBank
yqhO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqhO

unknown
locus
BSU_24510
pI
9.63
mw
32.71 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,542,439 2,543,314

    The protein

    [SW|Domains]

  • PNPLA domain (aa 5-196) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]
    description
    [pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE24510 ([gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCCCTCCCCCTC, downstream forward: _UP4_TATTAAAAAAGCGCTCTGTT
  • BKK24510 ([gene|51578F3BD1E639463CE84544D0A77CA648D5B76E|yqhO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATTCCCTCCCCCTC, downstream forward: _UP4_TATTAAAAAAGCGCTCTGTT