SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


coproheme decarboxylase
29.35 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
biosynthesis of heme
coproheme decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,866,596 3,867,360

    Phenotypes of a mutant

  • defect in heme biosynthesis
  • The protein

    Catalyzed reaction/ biological activity

  • coproheme --> protoheme + 2 CO2 + 4 H+ [pubmed|25646457]
  • Protein family

  • UPF0447 family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-41 [Pubmed|17218307]
  • [SW|Cofactors]

  • heme
  • Structure

  • [PDB|5T2K] (''Geobacillus stearothermophilus'') [pubmed|27936663]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A516 (ywfI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKK37670 ([gene|51B3ED39FC423164A6FD6271815E029137B362A9|hemQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCTTCACTCCCATT, downstream forward: _UP4_TAATATCCCCTCCCGCCCTA
  • Expression vectors

  • pGP2643: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • pGP2644: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • pGP2637: N-terminal Strep-tag, in [SW|pGP380], for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 28123057,25711532
  • Original Publications

  • 17218307,9353933,20543190,25646457,27758026,27982566,27599156,27936663,26083961,27597779