SubtiBank SubtiBank
ycgR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycgR

unknown
locus
BSU_03250
pI
9.50
mw
31.78 kDa
protein length
294 aa Sequence Blast
gene length
885 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    350,858 351,742

    The protein

    Protein family

  • UPF0718 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|51EF3C9A48FA7367576656F5E79D38D1B56BF6A5|ycgR]-[gene|99C8AA68035A9580FA3145ABE66F4DD63CDD6AE8|ycgQ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [pubmed|], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [[SigV]] mutant [Pubmed|21926231]
  • view in new tab

    genes
    [gene|1AA67AD33622538F7BAD64B54FAE6FD8103BF9BE|ycgS]-[gene|51EF3C9A48FA7367576656F5E79D38D1B56BF6A5|ycgR]-[gene|99C8AA68035A9580FA3145ABE66F4DD63CDD6AE8|ycgQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B996 (ycgR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1995 NBRP B. subtilis, Japan]
  • BKE03250 ([gene|51EF3C9A48FA7367576656F5E79D38D1B56BF6A5|ycgR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAACCTCCGCTCA, downstream forward: _UP4_TCACTACTGGTAAAGGGGTG
  • BKK03250 ([gene|51EF3C9A48FA7367576656F5E79D38D1B56BF6A5|ycgR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAACCTCCGCTCA, downstream forward: _UP4_TCACTACTGGTAAAGGGGTG