SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to oxygenase component of 4-hydroxyphenylacetate 3-monooxygenase
43.01 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,031,439 2,032,890

    The protein

    Catalyzed reaction/ biological activity

  • 4-hydroxyphenylacetate + FADH2 + O2 --> 3,4-dihydroxyphenylacetate + FAD + H+ + H2O (according to UniProt)
  • Protein family

  • FADH(2)-utilizing monooxygenase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2YYG] (from ''Thermus thermophilus'', 42% identity) [Pubmed|17804419]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A838 (yoaI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18620 ([gene|5224B7AD3B669120DBCC071540F6B37D11FD5260|yoaI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAGTTTCGCTCCTTC, downstream forward: _UP4_TGAAAAAACAGCGGGAAAAG
  • BKK18620 ([gene|5224B7AD3B669120DBCC071540F6B37D11FD5260|yoaI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAGTTTCGCTCCTTC, downstream forward: _UP4_TGAAAAAACAGCGGGAAAAG
  • References

  • 17804419