SubtiBank SubtiBank
yoaI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaI

similar to oxygenase component of 4-hydroxyphenylacetate 3-monooxygenase
locus
BSU_18620
pI
5.13
mw
43.01 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,031,439 2,032,890

    The protein

    Catalyzed reaction/ biological activity

  • 4-hydroxyphenylacetate + FADH2 + O2 --> 3,4-dihydroxyphenylacetate + FAD + H+ + H2O (according to UniProt)
  • Protein family

  • FADH(2)-utilizing monooxygenase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2YYG] (from ''Thermus thermophilus'', 42% identity) [Pubmed|17804419]
  • Expression and Regulation

    Operons

    genes
    [gene|5224B7AD3B669120DBCC071540F6B37D11FD5260|yoaI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A838 (yoaI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/838 NBRP B. subtilis, Japan]
  • BKE18620 ([gene|5224B7AD3B669120DBCC071540F6B37D11FD5260|yoaI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAGTTTCGCTCCTTC, downstream forward: _UP4_TGAAAAAACAGCGGGAAAAG
  • BKK18620 ([gene|5224B7AD3B669120DBCC071540F6B37D11FD5260|yoaI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAGTTTCGCTCCTTC, downstream forward: _UP4_TGAAAAAACAGCGGGAAAAG
  • References

  • 17804419