SubtiBank SubtiBank
yaaN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yaaN

unknown
locus
BSU_00260
pI
5.60
mw
43.67 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    36,478 37,638

    The protein

    Protein family

  • TelA family (together with [protein|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|YceH]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|YceH]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B895 (yaaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1894 NBRP B. subtilis, Japan]
  • BKE00260 ([gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATCGCTCTTACCCTCT, downstream forward: _UP4_TGATTACCAGTAAGTCTGGC
  • BKK00260 ([gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATCGCTCTTACCCTCT, downstream forward: _UP4_TGATTACCAGTAAGTCTGGC
  • GP640 (''[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]''::''kan'' trpC2), available in [SW|Jörg Stülke]'s lab
  • Expression vector

  • pGP2842: IPTG inducible expression, purification in ''E. coli'' with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • pGP2843: expression of Strep-''yaaN'' by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 9987136,22383849