SubtiBank SubtiBank
yaaN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yaaN

unknown
locus
BSU_00260
pI
5.60
mw
43.67 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    36,478 37,638

    The protein

    Protein family

  • TelA family (together with [protein|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|YceH]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|YceH]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B895 (yaaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1894 NBRP B. subtilis, Japan]
  • BKE00260 ([gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATCGCTCTTACCCTCT, downstream forward: _UP4_TGATTACCAGTAAGTCTGGC
  • BKK00260 ([gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATCGCTCTTACCCTCT, downstream forward: _UP4_TGATTACCAGTAAGTCTGGC
  • References

  • 9987136,22383849