SubtiBank SubtiBank
yotH
The papers of the month are back! Check them out! Link here

yotH

similar to propionyl-CoA carboxylase
locus
BSU19880
pI
5.39
mw
6.27 kDa
protein length
gene length
171 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,154,077 → 2,154,250

    Expression and Regulation

    Operons

    genes
    [gene|AFCA823BA7245A295B3282602A928D2CD0F8CD27|yosX]-[gene|B604367A80B7D3DF4A940C12A35EDF37B0E415F2|yotB]-[gene|6416197EF316D74998012765EF9819072C38D2E2|yotC]-[gene|470037C34BD5D3EB5BDAD85BD4178ABDB6330A62|yotD]-[gene|5C8815965146BCD8ED238258B3F820AA17241165|yotE]-[gene|177BAE8E5143CBE479B8EF6814F2A1066E72D658|yotF]-[gene|CE176CE32089F79C9BAC36641DDBBA8C9C38C957|yotG]-[gene|5240CC5115326ACBB2B73F7610987C842C246F24|yotH]-[gene|ADFAFAB949F0BED0681E35C3055DB0984DA7910E|yotI]-[gene|C5508537A5CB1E2F71329CD822242EE988D395F3|yotJ]-[gene|3C740F35E67CDD7FB6BF19E0FF43F973D254EF3E|yotK]-[gene|3899DF460037B569066F452EC50AD97672AA5ACA|yotM]-[gene|46826326719EB32B5733953EC090FD91CB59C5B6|sprB]
    description
    [Pubmed|25299644]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25299644], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|25299644], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|6977F18870004AD236539D9409255815E6BE9241|CsoR]: repression, [Pubmed|20233928], in [regulon|6977F18870004AD236539D9409255815E6BE9241|CsoR regulon]
  • regulation

  • ''[protein|search|sprB]'': expressed during the middle and late stages of [SW|sporulation] [Pubmed|25299644]
  • view in new tab

    Biological materials

    Mutant

  • BKE19880 (Δ[gene|5240CC5115326ACBB2B73F7610987C842C246F24|yotH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGGTATCTTTCCTCCAATC, downstream forward: _UP4_CAATGATTGAAATTTTTAAA
  • BKK19880 (Δ[gene|5240CC5115326ACBB2B73F7610987C842C246F24|yotH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGGTATCTTTCCTCCAATC, downstream forward: _UP4_CAATGATTGAAATTTTTAAA
  • References

  • 9387222,25299644