SubtiBank SubtiBank
ydeB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeB

similar to transcriptional regulator
locus
BSU_05130
pI
7.33
mw
17.60 kDa
protein length
153 aa Sequence Blast
gene length
462 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    560,151 560,612

    The protein

    Protein family

  • CarD family (single member, according to UniProt)
  • Structure

  • [PDB|4KBM] (from Mycobacterium tuberculosis, 35%) [pubmed|24055315]
  • Expression and Regulation

    Operons

    genes
    [gene|5251F15ECCB6043F1ED3D9AA1C2BB023FBA2D3A6|ydeB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C129 (ydeB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2127 NBRP B. subtilis, Japan]
  • BKE05130 ([gene|5251F15ECCB6043F1ED3D9AA1C2BB023FBA2D3A6|ydeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCCACCTCCATAT, downstream forward: _UP4_TAGATACATCCCAAAAGATA
  • BKK05130 ([gene|5251F15ECCB6043F1ED3D9AA1C2BB023FBA2D3A6|ydeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCCACCTCCATAT, downstream forward: _UP4_TAGATACATCCCAAAAGATA
  • References

  • 23543716,24055315