SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


UDP-N-acetyl-glucosamine transferase, synthesis of extracellular poly-N-acetylglucosamine
39.79 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
synthesis of extracellular poly-N-acetylglucosamine
UDP-N-acetyl-glucosamine transferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • Gene

    3,518,999 3,520,033

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BD843389F95BFB905071547AB243413A617F12A8|EpsH]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials


  • MGNA-A066 (yveT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34280 ([gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACAATAATGCTGACGAGCG, downstream forward: _UP4_ATGAAAGGCAGTGCGAAGCA
  • BKK34280 ([gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACAATAATGCTGACGAGCG, downstream forward: _UP4_ATGAAAGGCAGTGCGAAGCA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481
  • The EAR [SW|RNA switch]

  • 20374491,20230605