SubtiBank SubtiBank
yusI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yusI

similar to arsenate reductase
locus
BSU_32810
pI
5.59
mw
13.77 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.12|Resistance against toxic metals/ based on similarity]
  • Gene

    Coordinates
    3,366,573 3,366,929

    The protein

    Protein family

  • ArsC family (with [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] and [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx], according to UniProt)
  • Structure

  • [PDB|2M46] (from Staphylococcus aureus, 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]-[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B593 (yusI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1592 NBRP B. subtilis, Japan]
  • BKE32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA, downstream forward: _UP4_TAATGTAAATTTTTTTTGAA
  • BKK32810 ([gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTTCCCCCTCAATA, downstream forward: _UP4_TAATGTAAATTTTTTTTGAA