SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional regulator of puc genes
60.34 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
regulation of purine utilization
transcriptional regulator of puc genes ([SW|PucR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,328,762 3,330,357

    The protein

    Protein family

  • [SW|PucR family]
  • [SW|CdaR family] (according to UniProt)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A934 (yunI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32420 ([gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
  • BKK32420 ([gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGCATTCTCCTTTTC, downstream forward: _UP4_TAAAGTTTGTTACATTTTCT
  • References

  • 12374841,11344136,12029039,12823818,25755103