SubtiBank SubtiBank
lmrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lmrA

transcriptional regulator ([SW|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|search|yxaH ]and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
locus
BSU_02680
pI
5.03
mw
20.52 kDa
protein length
188 aa Sequence Blast
gene length
567 bp Sequence Blast
function
regulation of lincomycin resistance
product
transcriptional regulator
essential
no
synonyms
lin-2,yccB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    290,132 290,698

    The protein

    Protein family

  • [SW|TetR family]
  • Paralogous protein(s)

  • [protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR]
  • Effectors of protein activity

  • flavonoids such as quercetin serve as inducers, binding results in release from DNA [Pubmed|17483215]
  • Structure

  • [PDB|1SGM] ([protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR], 56% identity) [pubmed|16475182]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000222 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
    description
    [Pubmed|15317768]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12499232], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE02680 ([gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT, downstream forward: _UP4_TAAAAAAAACGACATACTAC
  • BKK02680 ([gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT, downstream forward: _UP4_TAAAAAAAACGACATACTAC
  • References

    Reviews

  • 24006471,25209494
  • Original publications

  • 15317768,17483215,12499232,21815947,16475182