SubtiBank SubtiBank
lmrA
The papers of the month are back! Check them out! Link here

lmrA

transcriptional regulator ([SW|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|search|yxaH ]and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
locus
BSU02680
pI
5.03
mw
20.52 kDa
protein length
188 aa Sequence Blast
gene length
564 bp Sequence Blast
function
regulation of lincomycin resistance
product
transcriptional regulator
essential
no
synonyms
lin-2,yccB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    290,132 → 290,698

    The protein

    Protein family

  • [SW|TetR family]
  • Paralogous protein(s)

  • [protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR]
  • Effectors of protein activity

  • flavonoids such as quercetin serve as inducers, binding results in release from DNA [Pubmed|17483215]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000222 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
    description
    [Pubmed|15317768]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12499232], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [Rny|search|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE02680 (Δ[gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT, downstream forward: _UP4_TAAAAAAAACGACATACTAC
  • BKK02680 (Δ[gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT, downstream forward: _UP4_TAAAAAAAACGACATACTAC
  • References

    Reviews

  • 24006471,25209494
  • Original publications

  • 15317768,17483215,12499232,21815947