SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


major high-affinity Na+-coupled glutamate/ aspartate symport protein, uptake of glyphosate
45.76 kDa
protein length
429 aa Sequence Blast
gene length
1290 bp Sequence Blast
glutamate and aspartate uptake
major Na+-coupled glutamate/ aspartate symport protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Dicarboxylate/amino acid:cation symporter]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,096,560 1,097,849

    Phenotypes of a mutant

  • impaired uptake of glutamate and aspartate [Pubmed|25344233]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of glutamate and aspartate
  • uptake of glyphosate and glufosinate [pubmed|30666812]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|622856EE642C42247C658DBD57E6A18C6E81FE58|GltP], [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|DctP]
  • Kinetic information

  • Km values: 37 +/- 5 µM for glutamate, 41 +/- 9 µM for aspartate [pubmed|25344233]
  • Effectors of protein activity

  • aspartate uptake is competitively inhibited by glutamate [pubmed|29995990]
  • Structure

  • [PDB|4IZM] (the protein from ''Pyrococcus horikoshii'', 35% identity, 73% similarity) [Pubmed|23563139]
  • [ 4KY0] (the glutamate transporter of ''Thermococcus kodakarensis'', 35% identity, 72% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BP233 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''spc''), available in [SW|Fabian Commichau]'s lab
  • BP235 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''spc '' Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::''cat''), available in [SW|Fabian Commichau]'s lab
  • GP2247 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2248 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP2722 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''zeo''), available in [SW|Jörg Stülke]'s lab
  • BKE10220 ([gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
  • BKK10220 ([gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA, downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
  • GP2831 (''Δ''''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3'' ''Δ''''[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP3063 ''gltT-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • for expression in ''B. subtilis'', in [SW|pAC7]: pBP56, available in [SW|Fabian Commichau]'s lab
  • References

  • 18763711,23563139,22383849,24013209,25344233,14596613,10588697,29995990,30666812