SubtiBank SubtiBank
ydbJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydbJ

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_04490
pI
4.73
mw
34.12 kDa
protein length
308 aa Sequence Blast
gene length
927 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    502,908 503,834

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|70858AED096A80C1EAEB81F4B048368B665AB515|YhcH]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 6-234) (according to UniProt)
  • Structure

  • [PDB|4YER] (from Thermotoga maritima, 32% identity)
  • [SW|Localization]

  • membrane associated (via [protein|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|YdbK]) [Pubmed|10092453]
  • Biological materials

    Mutant

  • BKE04490 ([gene|5364730C4DD7FFFB238DA190889CECF6C63F1050|ydbJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCCTTCCTCCTTTT, downstream forward: _UP4_GTCTAAATTAATTTGGAATG
  • BKK04490 ([gene|5364730C4DD7FFFB238DA190889CECF6C63F1050|ydbJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCCTTCCTCCTTTT, downstream forward: _UP4_GTCTAAATTAATTTGGAATG
  • References

  • 10092453,23033921,27120414