SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores inner membrane
14.67 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    1,148,744 1,149,145

    Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B203 (yisD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10680 ([gene|53833A2E7176C04AF2E3F7CD7FC9928DC1A0110D|gerPE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTCTGGCGCAAGCGG, downstream forward: _UP4_TAATAAACAGAGACTTCGAT
  • BKK10680 ([gene|53833A2E7176C04AF2E3F7CD7FC9928DC1A0110D|gerPE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTCTGGCGCAAGCGG, downstream forward: _UP4_TAATAAACAGAGACTTCGAT
  • References

  • 10715007