SubtiBank SubtiBank
pucJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucJ

uric acid permease
locus
BSU_32430
pI
9.64
mw
46.94 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
function
purine utilization
product
uric acid permease
essential
no
synonyms
yunJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,330,502 3,331,851

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|PbuX], [protein|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|PucK]
  • Structure

  • [PDB|3QE7] (E. coli uracil transporter, 31% identity) [pubmed|21423164]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12029039]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]-[gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A935 (yunJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/935 NBRP B. subtilis, Japan]
  • BKE32430 ([gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATAGTCCCTCCCTGTA, downstream forward: _UP4_TTAGAAAAAGAGGTGTAAAA
  • BKK32430 ([gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATAGTCCCTCCCTGTA, downstream forward: _UP4_TTAGAAAAAGAGGTGTAAAA
  • References

  • 11344136,12823818,12029039,25755103,21423164