SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


uric acid permease
46.94 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
purine utilization
uric acid permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,330,502 3,331,851

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|PbuX], [protein|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|PucK]
  • Structure

  • [PDB|3QE7] (E. coli uracil transporter, 31% identity) [pubmed|21423164]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab


    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A935 (yunJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32430 ([gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATAGTCCCTCCCTGTA, downstream forward: _UP4_TTAGAAAAAGAGGTGTAAAA
  • BKK32430 ([gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATAGTCCCTCCCTGTA, downstream forward: _UP4_TTAGAAAAAGAGGTGTAAAA
  • References

  • 11344136,12823818,12029039,25755103,21423164