SubtiBank SubtiBank
yhcF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhcF

similar to transcriptional regulator ([SW|GntR family])
locus
BSU_09060
pI
5.46
mw
13.81 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|GntR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    981,237 981,602

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Structure

  • [PDB|3NEU] (similar protein from ''Listeria innocua'', 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|74B0D594308D313A54C7163759628655382B1F94|yhcE]-[gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]-[gene|E71E305A0DE5AB6BE24CE47DC1ECCD99670C24D8|yhcG]-[gene|70858AED096A80C1EAEB81F4B048368B665AB515|yhcH]-[gene|BAD93C5EAD25F1A257907F4C631C02FE97C7BC89|yhcI]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B473 (yhcF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1472 NBRP B. subtilis, Japan]
  • BKE09060 ([gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGATTGGAATTGATTGTCCA, downstream forward: _UP4_AAAACATTCACAGAGGGAGG
  • BKK09060 ([gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGATTGGAATTGATTGTCCA, downstream forward: _UP4_AAAACATTCACAGAGGGAGG
  • References

  • 21815947,23504016