SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cysteine desulfurase
40.65 kDa
protein length
370 aa Sequence Blast
gene length
1113 bp Sequence Blast
cysteine desulfurase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    287,499 288,611

    The protein

    Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|NifZ], [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|NifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|5B87] (from Thermococcus onnurineus, corresponds to aa 4 ... 281, 26.5% identity) [pubmed|28536498]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C039 (ycbU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02660 ([gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATTCACTCCTTTA, downstream forward: _UP4_TAAACATGAAAAAGCCCCTG
  • BKK02660 ([gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATTCACTCCTTTA, downstream forward: _UP4_TAAACATGAAAAAGCCCCTG
  • References

    Research papers

  • 28536498