SubtiBank SubtiBank
ycbU

ycbU

cysteine desulfurase
locus
BSU_02660
pI
6.45
mw
40.65 kDa
protein length
370 aa Sequence Blast
gene length
1113 bp Sequence Blast
function
unknown
product
cysteine desulfurase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    287,499 288,611

    The protein

    Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|NifZ], [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|NifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO]
  • [SW|Cofactors]

  • PLP
  • Expression and Regulation

    Operons

    genes
    [gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C039 (ycbU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2037 NBRP B. subtilis, Japan]
  • BKE02660 ([gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATTCACTCCTTTA, downstream forward: _UP4_TAAACATGAAAAAGCCCCTG
  • BKK02660 ([gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATTCACTCCTTTA, downstream forward: _UP4_TAAACATGAAAAAGCCCCTG