SubtiBank SubtiBank
ycbU [2018-09-12 18:44:13]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycbU [2018-09-12 18:44:13]

cysteine desulfurase
locus
BSU02660
pI
6.45
mw
40.65 kDa
protein length
370 aa Sequence Blast
gene length
1110 bp Sequence Blast
function
unknown
product
cysteine desulfurase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    287,499 → 288,611

    The protein

    Protein family

  • class-V pyridoxal-phosphate-dependent aminotransferase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|NifZ], [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|NifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO]
  • Expression and Regulation

    Operons

    genes
    [gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C039 (ycbU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2037 NBRP B. subtilis, Japan]
  • BKE02660 (Δ[gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATTCACTCCTTTA, downstream forward: _UP4_TAAACATGAAAAAGCCCCTG
  • BKK02660 (Δ[gene|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|ycbU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATTCACTCCTTTA, downstream forward: _UP4_TAAACATGAAAAAGCCCCTG