SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|RNA polymerase] ECF-type [SW|sigma factor] YlaC
20.78 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
[category|SW 3.2.1|Transcription]
[SW|RNA polymerase] ECF-type [SW|sigma factor] YlaC

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • Gene

    1,544,085 1,544,606

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|ECF subfamily] (according to UniProt)
  • Effectors of protein activity

  • [protein|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|YlaD] acts as anti-sigma [Pubmed|16728958]
  • Structure

  • [PDB|5WUQ] ([protein|search|SigW ]in complex with the cytoplasmic domain of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW], 33% identity) [pubmed|28319136]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16501307], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]: sigma factor, [Pubmed|16501307], in [regulon|544344B61A804F367BB726976E0C87B61998490A|YlaC regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16501307], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab



  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    Biological materials


  • MGNA-B356 (ylaC::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A908 ( ''ylaC''::''kan''), [Pubmed|15838020], available at [ BGSC]
  • BKE14730 ([gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAATGGAATCCCTATGCT, downstream forward: _UP4_AAAAGTAGAGAGGAGGAGCG
  • BKK14730 ([gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCAATGGAATCCCTATGCT, downstream forward: _UP4_AAAAGTAGAGAGGAGGAGCG
  • References


  • 24921931
  • Original publications

  • 16501307,16728958,17675383,20817771,28319136,29760236