SubtiBank SubtiBank
gltR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltR

transcriptional regulator ([SW|LysR family])
locus
BSU_26670
pI
6.65
mw
32.79 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms
yrdL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,725,837 2,726,727

    Phenotypes of a mutant

  • The function of this protein is unknown. However, certain mutant forms are able to activate expression of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon (and thus to replace the cognate activator protein [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]) [pubmed|9023181,28294562]
  • The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|5Z72] (B. amyloliquefaciens [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC], 22% identity)
  • Additional information

  • The function of this protein is unknown. However, certain mutant forms are able to activate expression of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon (and thus to replace the cognate activator protein [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]) [pubmed|9023181,28294562]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000049 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/gltR.html DBTBS]) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9023181], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|544CE1370BE7444F361F62808E320CE97C3C2F93|GltR]: negative autoregulation, in [regulon|544CE1370BE7444F361F62808E320CE97C3C2F93|GltR regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP345 (erm), available in [SW|Jörg Stülke]'s lab
  • BKE26670 ([gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAGTCCTCCATAGTTG, downstream forward: _UP4_TAAATAAATGGATGGAAGGC
  • BKK26670 ([gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAGTCCTCCATAGTTG, downstream forward: _UP4_TAAATAAATGGATGGAAGGC
  • Expression vectors

  • pBP421 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP382]) (available in [SW|Fabian Commichau]'s lab)
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • References

  • 9023181,28294562