SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


aspartokinase III
49.66 kDa
protein length
454 aa Sequence Blast
gene length
1365 bp Sequence Blast
aspartokinase III

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    430,623 431,987

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-aspartate --> 4-phospho-L-aspartate + ADP (according to UniProt)
  • Protein family

  • aspartokinase family (with [protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|DapG] and [protein|F7B947938FB40E54D89A719E9610C5A4AA400674|LysC], according to UniProt)
  • [SW|Domains]

  • [SW|ACT domain] (aa 389 ... 454) (according to the Interpro database)
  • Effectors of protein activity

  • inhibited by the simultaneous presence of threonine and lysine [Pubmed|11471740]
  • Structure

  • [PDB|3TVI] (from Clostridium acetobutylicum, 37% identity) [pubmed|25170437]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials


  • MGNA-C009 (yclM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03790 ([gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACATCTCCTAATG, downstream forward: _UP4_TAATCGTACATAAATAGCGG
  • BKK03790 ([gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACATCTCCTAATG, downstream forward: _UP4_TAATCGTACATAAATAGCGG
  • lacZ fusion

  • pBP318 (in [SW|pAC5]), available in [SW|Fabian Commichau]'s lab [Pubmed|27260660]
  • References


  • 19946135,22079167
  • Original publications

  • 11471740,23569278,2152900,2153658,22383849,27260660,25170437