SubtiBank SubtiBank
purH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purH

phosphoribosylaminoimidazole carboxamide formyltransferase
locus
BSU_06520
pI
5.13
mw
55.57 kDa
protein length
512 aa Sequence Blast
gene length
1539 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylaminoimidazole carboxamide formyltransferaseand inosine-monophosphate cyclohydrolase
essential
no
ec
2.1.2.3
synonyms
purJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    708,594 710,132

    Phenotypes of a mutant

  • more resistant than wild-type to zinc limitation when grown on rich medium (LB), this is blocked by simultaneous deletion of [gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB] (reason: accumulation of ZTP that stimulates the binding of [protein|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|ZagA] to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE], and thus folate biosynthesis during zinc limitation) [pubmed|31132310]
  • The protein

    Catalyzed reaction/ biological activity

  • (6S)-10-formyltetrahydrofolate + 5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide --> (6S)-5,6,7,8-tetrahydrofolate + 5-formamido-1-(5-phospho-D-ribosyl)imidazole-4-carboxamide (according to UniProt)
  • H2O + IMP --> 5-formamido-1-(5-phospho-D-ribosyl)imidazole-4-carboxamide (according to UniProt)
  • Protein family

  • purH family (single member, according to UniProt)
  • [SW|Domains]

  • MGS-like domain (aa 1-146) (according to UniProt)
  • Structure

  • [PDB|1ZCZ] (from ''Thermotoga maritima'', 36% identity, 54% similarity) [Pubmed|18260100]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06520 ([gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTGATTAATGCACGTTTAA, downstream forward: _UP4_AAACATTAAGGGGATGAAAA
  • BKK06520 ([gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTGATTAATGCACGTTTAA, downstream forward: _UP4_AAACATTAAGGGGATGAAAA
  • References

  • 3036807,12923093,15378759,7638212,31132310