SubtiBank SubtiBank
purH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purH

phosphoribosylaminoimidazole carboxamide formyltransferase
locus
BSU_06520
pI
5.13
mw
55.57 kDa
protein length
512 aa Sequence Blast
gene length
1539 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylaminoimidazole carboxamide formyltransferaseand inosine-monophosphate cyclohydrolase
essential
no
ec
2.1.2.3
synonyms
purJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    708,594 710,132

    Phenotypes of a mutant

  • more resistant than wild-type to zinc limitation when grown on rich medium (LB), this is blocked by simultaneous deletion of [gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB] (reason: accumulation of ZTP that stimulates the binding of [protein|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|ZagA] to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE], and thus folate biosynthesis during zinc limitation) [pubmed|31132310]
  • The protein

    Catalyzed reaction/ biological activity

  • (6S)-10-formyltetrahydrofolate + 5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide --> (6S)-5,6,7,8-tetrahydrofolate + 5-formamido-1-(5-phospho-D-ribosyl)imidazole-4-carboxamide (according to UniProt)
  • H2O + IMP --> 5-formamido-1-(5-phospho-D-ribosyl)imidazole-4-carboxamide (according to UniProt)
  • Protein family

  • purH family (single member, according to UniProt)
  • Structure

  • [PDB|1ZCZ] (from ''Thermotoga maritima'', 36% identity, 54% similarity) [Pubmed|18260100]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06520 ([gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTGATTAATGCACGTTTAA, downstream forward: _UP4_AAACATTAAGGGGATGAAAA
  • BKK06520 ([gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTGATTAATGCACGTTTAA, downstream forward: _UP4_AAACATTAAGGGGATGAAAA
  • References

  • 3036807,12923093,15378759,7638212,31132310