SubtiBank SubtiBank
yutC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yutC

unknown
locus
BSU_32320
pI
6.34
mw
23.50 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,319,676 3,320,308

    Expression and Regulation

    Operons

    genes
    [gene|54F0C32DF50E0D26916804161DCC17BA83E0A086|yutC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|30782632], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • MGNA-A977 (yutC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/977 NBRP B. subtilis, Japan]
  • BKE32320 ([gene|54F0C32DF50E0D26916804161DCC17BA83E0A086|yutC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCAATCCCTCCTCA, downstream forward: _UP4_GCCAGATGATCTGGCGTTTT
  • BKK32320 ([gene|54F0C32DF50E0D26916804161DCC17BA83E0A086|yutC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATCAATCCCTCCTCA, downstream forward: _UP4_GCCAGATGATCTGGCGTTTT
  • References

    Research papers

  • 30782632