SubtiBank SubtiBank
narJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

narJ

chaperone for the nitrate reductase (protein J)
locus
BSU_37260
pI
4.61
mw
21.06 kDa
protein length
184 aa Sequence Blast
gene length
555 bp Sequence Blast
function
nitrate respiration, nitrogen assimilation
product
chaperone for the nitrate reductase (protein J)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • Gene

    Coordinates
    3,824,226 3,824,780

    The protein

    Protein family

  • NarJ/NarW family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B992698A12EE9D17DCEF075F82396D5456D35A20|narG]-[gene|6181C785427277C097B81D67A93213AEAF701FF4|narH]-[gene|5528AD62C1BF608D181C8960C88620B63B1E60A0|narJ]-[gene|20060F4C1939FB9A10CB279745D75D0A16627EC6|narI]
    description
    [Pubmed|8846791,16428414]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8846791,16428414], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|Fnr]) [Pubmed|8846791,16428414]
  • view in new tab

    Biological materials

    Mutant

  • BKE37260 ([gene|5528AD62C1BF608D181C8960C88620B63B1E60A0|narJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGTTACACCTCATTT, downstream forward: _UP4_AGCGTTGAAGGGGCTGTTCA
  • BKK37260 ([gene|5528AD62C1BF608D181C8960C88620B63B1E60A0|narJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGTTACACCTCATTT, downstream forward: _UP4_AGCGTTGAAGGGGCTGTTCA
  • References

    Reviews

  • 11289299
  • Original publications

  • 9352926,8846791,16428414