SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


glutamate 5-kinase
39.30 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
biosynthesis of proline
glutamate 5-kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of proline]
  • Gene

    1,378,496 1,379,593

    Phenotypes of a mutant

  • auxotrophic for proline [Pubmed|21784929]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + L-glutamate --> ADP + L-glutamyl 5-phosphate (according to UniProt)
  • Protein family

  • glutamate 5-kinase family (with [protein|3F47513FB71276EF1E99B8C427DC8DC0786F8C19|ProJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|3F47513FB71276EF1E99B8C427DC8DC0786F8C19|ProJ]
  • [SW|Domains]

  • PUA domain (aa 276-353) (according to UniProt)
  • Effectors of protein activity

  • the enzymatic activity is feedback-inhibited by proline {PubMed|16958849}}
  • Structure

  • [PDB|2J5V] (from E. coli, 40% identity) [pubmed|17321544]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21233158], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • induced by proline limitation ([SW|T-box]) [Pubmed|21233158]
  • expression requires functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • [protein|1629A875FCCA0C0EB1C959ED31BB6B3CFA839BF9|ProA] is absent from the membrane proteome of a '[protein|A01637E1BFABA20A2923BA85A25CCD8A0D665F78|BdbC]-[protein|CED818CEF5B573A40F382157375E60C0B331F098|BdbD]' mutant [PubMed|22540663]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE13120 ([gene|5592C5163CF024289B850916516E2C8C7AD43136|proB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTCTCCTCCGCGGC, downstream forward: _UP4_GTAAAAGACTAGGAGGCGGA
  • BKK13120 ([gene|5592C5163CF024289B850916516E2C8C7AD43136|proB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTCTCCTCCGCGGC, downstream forward: _UP4_GTAAAAGACTAGGAGGCGGA
  • References


  • 25367752
  • Original publications

  • 19258532,16958849,17562291,21233158,21784929,28752945,17321544,29794222,30355672