SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


bacteriocin producer immunity protein
12.12 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
immunity to sublancin
bacteriocin producer immunity protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,269,988 2,270,305

    Phenotypes of a mutant

  • essential (facultative, ''[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'' can be deleted if ''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]'' is also absent) [Pubmed|19047653], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • mediates immunity to sublancin [Pubmed|19047653]
  • [SW|Localization]

  • membrane anchored protein [Pubmed|19047653] [Pubmed|18763711]
  • Expression and Regulation



    additional information:

  • the expression is homogeneous in the population [pubmed|30808982]
  • view in new tab

    Biological materials


  • GP1565 (''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'', aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE21490 ([gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA, downstream forward: _UP4_TGAACATAAAAAAGTACCTT
  • BKK21490 ([gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA, downstream forward: _UP4_TGAACATAAAAAAGTACCTT
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References

  • 18763711,19047653,22383849,28189581,30808982