SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


DNA-binding protein, spatial regulator of [SW|cell division] to protect the nucleoid, and timing device with an important role in the coordination of chromosome segregation and [SW|cell division], Z ring placement
32.64 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
control of [SW|cell division]
effector of nucleoid occlusion

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,207,897 4,208,748

    Phenotypes of a mutant

  • a ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]'' double mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • The protein

    Catalyzed reaction/ biological activity

  • binds specific sites on the chromosome [Pubmed|19494834]
  • Protein family

  • ParB family (with [protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB], according to UniProt)
  • Paralogous protein(s)

  • [protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB]
  • Structure

  • [PDB|1VZ0] ([protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB] from Thermus thermophilus, 48% from aa 30 ... 219) [pubmed|15228524]
  • [SW|Localization]

  • associated to the cell membrane [Pubmed|25568309]
  • Expression and Regulation



    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • MGNA-B874 (yyaA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40990 ([gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACCTACACCACCTTT, downstream forward: _UP4_TAGAAGCTCTCCTGAAAAGC
  • BKK40990 ([gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACCTACACCACCTTT, downstream forward: _UP4_TAGAAGCTCTCCTGAAAAGC
  • GFP fusion

  • available in the [SW|Jeff Errington] lab
  • labs

  • Jeff Errington, Newcastle, UK [ Homepage]
  • David Rudner, Harvard, USA [ Homepage]
  • References


  • 19680248,19884039,25460802,26706151,28500529
  • Original Publications

  • 16549676,11807071,19494834,15210112,11948146,22457634,23701187,24097947,25568309,26020636,28723932,15228524