SubtiBank SubtiBank
noc
The papers of the month are back! Check them out! Link here

noc

DNA-binding protein, spatial regulator of cell division to protect the nucleoid, and timing device with an important role in the coordination of chromosome segregation and cell division, Z ring placement
locus
BSU40990
pI
5.81
mw
32.64 kDa
protein length
283 aa Sequence Blast
gene length
849 bp Sequence Blast
function
control of cell division
product
effector of nucleoid occlusion
essential
no
synonyms
yyaA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,207,897 → 4,208,748

    Phenotypes of a mutant

  • a ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]'' double mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • The protein

    Catalyzed reaction/ biological activity

  • binds specific sites on the chromosome [Pubmed|19494834]
  • Protein family

  • ParB family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA], [protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB]
  • [SW|Localization]

  • associated to the cell membrane [Pubmed|25568309]
  • Expression and Regulation

    Operons

    genes
    [gene|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF]-[gene|7809B4F5B9172EBB6C91BDE7B673FB08E82763FF|gidA]-[gene|CCB7EE1D049585979303148FBDE0D42549E648DE|gidB]-[gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]
    description
    [Pubmed|11807071]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B874 (yyaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1873 NBRP B. subtilis, Japan]
  • BKE40990 (Δ[gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACCTACACCACCTTT, downstream forward: _UP4_TAGAAGCTCTCCTGAAAAGC
  • BKK40990 (Δ[gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACCTACACCACCTTT, downstream forward: _UP4_TAGAAGCTCTCCTGAAAAGC
  • GFP fusion

  • available in the [SW|Jeff Errington] lab
  • Labs working on this gene/protein

  • Jeff Errington, Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/jeff.errington Homepage]
  • David Rudner, Harvard, USA [http://rudnerlab.med.harvard.edu/ Homepage]
  • References

    Reviews

  • 19680248,19884039,25460802,26706151,28500529
  • Original Publications

  • 16549676,11807071,19494834,15210112,11948146,22457634,23701187,24097947,25568309,26020636,28723932