SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


bacillaene synthase trans-acting acyltransferase
32.31 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
polyketide (bacillaene) synthesis
bacillaene synthase trans-acting acyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,783,763 1,784,629

    The protein

    Catalyzed reaction/ biological activity

  • holo-[ACP] + malonyl-CoA --> CoA + malonyl-[ACP] (according to UniProt)
  • Protein family

  • fabD family (with [protein|BB8542A6444564B21FF5DB6E2C75192C6DA2DFB8|FabD] and [protein|CB0B856B22984DD5B10F01DD07C3961FAA742923|PksE], according to UniProt)
  • Structure

  • [PDB|5DZ6]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A016 (pksC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17100 ([gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTCAAAGCCACCCT, downstream forward: _UP4_TAAAGCATTTGCCCCTATGG
  • BKK17100 ([gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTCAAAGCCACCCT, downstream forward: _UP4_TAAAGCATTTGCCCCTATGG
  • References

  • 22383849,21505242,24187085