SubtiBank SubtiBank
yuzI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yuzI

unknown
locus
BSU_31319
pI
9.81
mw
9.80 kDa
protein length
gene length
264 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,218,215 3,218,478

    Expression and Regulation

    Operons

    genes
    [gene|55CDB094A8139B3273916193EEF6FC5996FD1C99|yuzI]-[gene|6FC2777AEF26F17F6908CA80459EE1E2523F275B|yugP]
    description
    [Pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE31319 ([gene|55CDB094A8139B3273916193EEF6FC5996FD1C99|yuzI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31319 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCATCCTTTTTG, downstream forward: _UP4_TAATCGTAATAGAGAAATGA
  • BKK31319 ([gene|55CDB094A8139B3273916193EEF6FC5996FD1C99|yuzI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31319 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCATCCTTTTTG, downstream forward: _UP4_TAATCGTAATAGAGAAATGA