SubtiBank SubtiBank
yrrI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrrI

membrane protein, similar to coordinator of zonal elongation, may control [category|SW 1.1.1|Cell wall synthesis] by the [category|SW 1.1.1.7|Penicillin-binding proteins]
locus
BSU_27420
pI
8.75
mw
39.44 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
function
may control [SW|cell wall synthesis ]by the [SW|penicillin-binding proteins]
product
similar to coordinator of zonal elongation
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,801,141 2,802,202

    The protein

    Protein family

  • [SW|autoinducer-2 exporter (AI-2E) (TC 2.A.86) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5B769207B05D93FEC36E97BB7074F29BB290C55A|YubA], [protein|42D1A2198CB4C738F5D4C6FA95B1BA24D5620F7E|YueF]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A856 (yrrI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/856 NBRP B. subtilis, Japan]
  • BKE27420 ([gene|561308269D6A42506DB61EA86ECD1F96E5886920|yrrI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCTTTCACCTCACCT, downstream forward: _UP4_TGACATCGGCGTGCCGCTTG
  • BKK27420 ([gene|561308269D6A42506DB61EA86ECD1F96E5886920|yrrI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCTTTCACCTCACCT, downstream forward: _UP4_TGACATCGGCGTGCCGCTTG
  • References

    Research papers

  • 27941863