SubtiBank SubtiBank
rplI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

rplI

ribosomal protein
locus
BSU_40500
pI
9.96
mw
16.21 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
translation
product
ribosomal protein L9
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    4,163,197 4,163,646

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL9 family (single member, according to UniProt)
  • Structure

  • [PDB|1DIV] (Geobacillus stearothermophilus)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
    description
    [Pubmed|22383849]

    additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • BKE40500 ([gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTCTGTACGCCTCC, downstream forward: _UP4_TAATAGAAAAGAGGCTTGGA
  • BKK40500 ([gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTCTGTACGCCTCC, downstream forward: _UP4_TAATAGAAAAGAGGCTTGGA
  • References

  • 19653700,25903689