SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


DNA repair and genetic recombination
64.31 kDa
protein length
576 aa Sequence Blast
gene length
1731 bp Sequence Blast
DNA repair and genetic recombination
DNA integrity scanning protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,520,557 2,522,287

    The protein

    Catalyzed reaction/ biological activity

  • RecN stimulates polymerizing activity of [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|PnpA] [Pubmed|21859751]
  • Protein family

  • recN family (single member, according to UniProt)
  • Structure

  • [PDB|4AD8] (from Deinococcus radiodurans, 30% identity) [pubmed|23085075]
  • [SW|Localization]

  • nucleoid (multiple) [Pubmed|16479537]
  • evenly distributed in growing cells [Pubmed|21859751]
  • upon DNA damage, RecN forms a single focus per nucleoid [Pubmed|21859751], recruitment is affected by the presence of [protein|A3A2EF3C95B833A11843553107D781EDEFF0BC41|fumarase] [pubmed|29140245]
  • Expression and Regulation




  • by [protein|search|sRNA] [protein|search|sr1]
  • additional information

  • expression is fourfold increased upon depletion of ''[SW|nusA]'' [ Reference]
  • view in new tab


    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials


  • 1A891 ( ''recN''::''cat''), [Pubmed|8510642], available at [ BGSC]
  • BKE24240 ([gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACAGCATTACACCTCTT, downstream forward: _UP4_TAAGCTGCGCGAGAAGCGCA
  • BKK24240 ([gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]::kan trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CAAACAGCATTACACCTCTT, downstream forward: _UP4_TAAGCTGCGCGAGAAGCGCA
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [ homepage]
  • References


  • 19308706,21517913,22933559,23380520,32286623
  • Original publications

  • 15849320,19060143,16385024,17999999,2106508,19730681,16479537,21859751,24373815,15186413,8510642,29140245,23085075,30192981,30401797