SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


allantoin permease
53.82 kDa
protein length
490 aa Sequence Blast
gene length
1473 bp Sequence Blast
purine utilization
allantoin permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,752,280 3,753,752

    The protein

    Catalyzed reaction/ biological activity

  • uptake of allantoin [Pubmed|26967546]
  • Protein family

  • purine-cytosine permease (2.A.39) family (with [protein|CB969A2D60F106466605052299F2A5FF5A20E9ED|YxlA], according to UniProt)
  • Structure

  • [PDB|2JLN] (from Microbacterium liquefaciens, 27% identity) [pubmed|18927357]
  • [SW|Localization]

  • cell membrane [Pubmed|26967546]
  • Expression and Regulation



    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-A897 (ywoE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36470 ([gene|5681A5F186AD4B8C81B78FD9DDAE2C0624BE7CAF|pucI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCTCCCCTTTCC, downstream forward: _UP4_TAAGATCTATTTAGACGGTA
  • BKK36470 ([gene|5681A5F186AD4B8C81B78FD9DDAE2C0624BE7CAF|pucI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCTCCCCTTTCC, downstream forward: _UP4_TAAGATCTATTTAGACGGTA
  • References

  • 11344136,12029039,12029039,26967546,27766092,18927357