SubtiBank SubtiBank
yyaL
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yyaL

unknown
locus
BSU_40820
pI
4.92
mw
78.57 kDa
protein length
689 aa Sequence Blast
gene length
2070 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    4,191,198 4,193,267

    The protein

    Paralogous protein(s)

  • [protein|735BF44BDC6A7480EB5F041AECC9451B3A0413EE|YyaO]: the N-terminal 60 amino acids share 94% identity
  • Structure

  • [PDB|3IRA] (N-terminal domain, aa 5 ... 177, from Methanosarcina mazei, 61% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]-[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]-[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B862 (yyaL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1861 NBRP B. subtilis, Japan]
  • BKE40820 ([gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATCACCTTCTTCCT, downstream forward: _UP4_CACACATTAATAAGCAGCAG
  • BKK40820 ([gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATCACCTTCTTCCT, downstream forward: _UP4_CACACATTAATAAGCAGCAG