SubtiBank SubtiBank
rocG
The papers of the month are back! Check them out! Link here

rocG

trigger enzyme, glutamate dehydrogenase and effector protein for [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]
locus
BSU37790
pI
6.28
mw
46.48 kDa
protein length
424 aa Sequence Blast
gene length
1272 bp Sequence Blast
function
arginine utilization, controls the activity of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]
product
glutamate dehydrogenase
essential
no
ec
1.4.1.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.2|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • Gene

    Coordinates
    3,880,740 → 3,882,014

    Phenotypes of a mutant

  • Poor growth on complex media such as SP (sporulation medium). No growth in minimal media with arginine as the only carbon source. Rapid accumulation of suppressor mutants ([gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|''gudB1'']]])
  • sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin (suppressed by activation of ''[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'') due to the downregulation of the [SW|SigW regulon] [Pubmed|22178969]
  • transcription profile of a ''[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]'' mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34383&submit.x=22&submit.y=9 GEO] [Pubmed|22178969]
  • The protein

    Catalyzed reaction/ biological activity

  • L-glutamate + H2O + NAD+ = 2-oxoglutarate + NH3 + NADH + H+ (according to Swiss-Prot), controls the activity of the [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] transcription activator [Pubmed|17608797]
  • Protein family

  • Glu/Leu/Phe/Val dehydrogenases family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|GudB]
  • Kinetic information

  • KM [glutamate] = 2.9 mM, KM [ammonium] = 18 mM [Pubmed|20630473]
  • [SW|Cofactors]

  • NAD+/NADH + H+
  • Structure

  • [PDB|3K92] (super-repressor mutant that is capable of constitutive inactivation of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC], E93K mutation) [Pubmed|20630473]
  • Expression and Regulation

    Operons

    genes
    [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]
    description
    [Pubmed|10468601]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10468601], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|10468601,12634342], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|17183217], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|15150224], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • additional information

  • Activation by [protein|search|RocR] requires binding of [protein|search|RocR] to a downstream element [PubMed|12634342]
  • view in new tab

    Biological materials

    Mutant

  • GP747 (spc), GP726 (aphA3), GP810 (del tet), GP1157 (cat) all available in [SW|Jörg Stülke]'s lab
  • BKE37790 (Δ[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
  • BKK37790 (Δ[gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCACCTCATTGT, downstream forward: _UP4_TAATTTGAGAAGCCTCCGCA
  • Expression vector

  • expression of native ''rocG'' in ''B. subtilis'': pGP529 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab [Pubmed|18326565]
  • for purification of RocG from ''E. coli'' carrying an N-terminal Strep-tag: pGP902 (in [SW|pGP172]), a series of ''rocG'' variants is also available in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pWH844]: pGP860, available in [SW|Jörg Stülke]'s lab
  • purification from ''B. subtilis'' with an N-terminal Strep-tag, for [SW|SPINE], (in [SW|pGP380]): pGP1709, available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab [Pubmed|17183217]
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany
  • [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Fabian Commichau] University of Göttingen, Germany
  • [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]
  • References

    Reviews

  • 19698086,8299344,7705101,19895831,22625175,28615289
  • Enzymatic activity of RocG

  • 18603778,16244435,16195607,18326565,9829940,20630473,21965396,25711804,28468957
  • Function in the control of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] activity

  • 15150225,17994626,17608797,17183217,20630473
  • Expression of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]

  • 12634342,15150224,10468601,9829940,22900538,20817675,25777015,25880922,27766092
  • Structural analysis of glutamate dehydrogenase

  • 8263917,20630473
  • Bypass of [gene|search|rocG ]mutations

  • 21219666,22178973,23785476
  • Additional publications

  • 23338837,23419162,22178969,24473333,29242163