SubtiBank SubtiBank
cheV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cheV

modulation of CheA activity in response to attractants
locus
BSU_14010
pI
4.62
mw
34.48 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
control of CheA activity
product
CheA modulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.2|Coupling proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    1,473,605 1,474,516

    Phenotypes of a mutant

  • ''[gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV] [gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]'' double mutants exhibit complete loss of chemotaxis [Pubmed|21098025]
  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Paralogous protein(s)

  • [protein|887D84520DF3D5F22DED525C1C17130EDE60DC36|CheW]:
  • [SW|Domains]

  • N-terminal [protein|887D84520DF3D5F22DED525C1C17130EDE60DC36|CheW]-like domain, C-terminal two-component receiver domain [Pubmed|11553614]
  • Modification

  • the C-terminal two-component receiver domain is phosphorylated on a Asp residue by [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] [Pubmed|11553614]
  • [SW|Localization]

  • forms lateral clusters (phosphorylated form), but in the presence of high asparagine concentration (non-phosphorylated form) there is a reversible re-localization to the poles of the cell [Pubmed|21098025]
  • Expression and Regulation

    Operons

    genes
    [gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV]
    description
    [Pubmed|8169223]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8169223], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, CheV is present with 7,500 /- 2,000 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • DS70 (''cheV''::''mls'' in NCIB3610) [Pubmed|12864845]
  • BKE14010 ([gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCAATCCCTCGCTATT, downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
  • BKK14010 ([gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCAATCCCTCGCTATT, downstream forward: _UP4_TAAATAAAAACAGCCGTTGC
  • References

    Reviews

  • 18774298
  • Original publications

  • 12864845,26122431,8169224,8169223,11553614,14731274,21098025,21515776,26844549