SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to [SW|ABC transporter] (binding protein)
38.00 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
putative [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Unknown ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,132,370 3,133,374

    The protein

    Protein family

  • bacterial solute-binding protein SsuA/TauA family (with [protein|B47C64731FCAA086CA563EEE95D3205428E51EFC|SsuA], according to Uniprot)
  • Structure

  • [PDB|3QSL] (from Bordetella sp., 26% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • MGNA-A301 (ytlA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30595 ([gene|56E482D9CAC6E350140FD21A1C4AC8820B918CDA|ytlA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGACAACCTCCTTAT, downstream forward: _UP4_TCGGAGAAATAGGAGGCGCC
  • BKK30595 ([gene|56E482D9CAC6E350140FD21A1C4AC8820B918CDA|ytlA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGACAACCTCCTTAT, downstream forward: _UP4_TCGGAGAAATAGGAGGCGCC
  • References

  • 10092453,9387221,15699190,15383836