SubtiBank SubtiBank
manP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

manP

mannose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBCA of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] activity
locus
BSU_12010
pI
6.72
mw
61.81 kDa
protein length
650 aa Sequence Blast
gene length
1953 bp Sequence Blast
function
mannose uptake and phosphorylation, control of [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] activity
product
mannose-specific [category|SW 1.2.2|PTS], EIIBCA
essential
no
synonyms
yjdD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.9|Utilization of mannose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,272,725 1,274,677

    The protein

    Catalyzed reaction/ biological activity

  • transport and concomitant phosphorylation of mannose
  • D-mannose + Nπ-phospho-L-histidyl-[protein] --> D-mannose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|FruA]
  • Modification

  • phosphorylation on Ser-365 [Pubmed|17218307]
  • Structure

  • [PDB|2R48] (IIA domain)
  • [PDB|2R4Q] ([protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|FruA], IIB domain, 56% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
    description
    [Pubmed|20139185]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [regulon|RNA switch|RNA switch]: termination/antitermination, expession may be controlled by a potential [SW|RNA switch] located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF], in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A270 (yjdD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/270 NBRP B. subtilis, Japan]
  • BKE12010 ([gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA, downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
  • BKK12010 ([gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA, downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
  • References

  • 10627040,17218307,10627040,20139185,23033921,23551403,26238998