SubtiBank SubtiBank
ybgG

ybgG

homocysteine methyltransferase
locus
BSU_02410
pI
4.86
mw
34.58 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
function
biosynthesis of methionine
product
homocysteine methyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.11|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    Coordinates
    261,656 262,603

    The protein

    Catalyzed reaction/ biological activity

  • S-methyl-L-methionine + L-homocysteine --> 2 L-methionine (according to UniProt)
  • [SW|Domains]

  • Hcy-binding domain (aa 2-309) (according to UniProt)
  • [SW|Cofactors]

  • Zn2+ (according to UniProt)
  • Structure

  • [PDB|5DML] (from ''Escherichia coli'', 52% identity) [pubmed|26564203]
  • Expression and Regulation

    Operons

    genes
    [gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]
    description
    [Pubmed|15995196]
    view in new tab

    genes
    [gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]-[gene|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|ybgF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B941 (ybgG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1940 NBRP B. subtilis, Japan]
  • BKE02410 ([gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATGTACCGATGCCT, downstream forward: _UP4_TGACTTATCGGAATAGTTTG
  • BKK02410 ([gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATGTACCGATGCCT, downstream forward: _UP4_TGACTTATCGGAATAGTTTG
  • References

  • 11267663,15995196,9882684,11898408,26564203