SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


homocysteine methyltransferase
34.58 kDa
protein length
315 aa Sequence Blast
gene length
948 bp Sequence Blast
biosynthesis of methionine
homocysteine methyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    261,656 262,603

    The protein

    Catalyzed reaction/ biological activity

  • S-methyl-L-methionine + L-homocysteine --> 2 L-methionine (according to UniProt)
  • [SW|Domains]

  • Hcy-binding domain (aa 2-309) (according to UniProt)
  • [SW|Cofactors]

  • Zn2+ (according to UniProt)
  • Structure

  • [PDB|5DML] (from ''Escherichia coli'', 52% identity) [pubmed|26564203]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B941 (ybgG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02410 ([gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATGTACCGATGCCT, downstream forward: _UP4_TGACTTATCGGAATAGTTTG
  • BKK02410 ([gene|577723B2BF662A44D55DC84444ED64276D8DED17|ybgG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATGTACCGATGCCT, downstream forward: _UP4_TGACTTATCGGAATAGTTTG
  • References

  • 11267663,15995196,9882684,11898408,26564203