SubtiBank SubtiBank


urease (gamma subunit)
11.32 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
utilization of urea as alternative nitrogen source
urease (gamma subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of urea]
  • Gene

    3,768,791 3,769,108

    The protein

    Catalyzed reaction/ biological activity

  • 2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
  • Protein family

  • urease gamma subunit family (single member, according to UniProt)
  • Structure

  • [PDB|2FVH] (from ''Mycobacterium tuberculosis'', 57% identity, 62% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9287005], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9287005], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR]: repression, [Pubmed|9287005], in [regulon|641C4BDD9702804642E1753A9C779E80FABB3919|GlnR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9287005], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12374841], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|9287005,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
  • view in new tab

    Biological materials


  • BKE36660 ([gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTAGTCCTCCTTCTT, downstream forward: _UP4_CCAATTTCTGCGGAGGTGAA
  • BKK36660 ([gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTAGTCCTCCTTCTT, downstream forward: _UP4_CCAATTTCTGCGGAGGTGAA
  • References


  • 23539618,19363030
  • Original publications

  • 12374841,18083814,12618455,9287005,9287005,12374841,9287005,1670935,16199586,25755103